Show:

6835 results

X-ray diffraction data for the Crystal structure of M. smegmatis GMP reductase with XMP* intermidiate in complex with NADP+ and IMP.
X-ray diffraction data for the KEAP1 complexed to linear peptide 6
X-ray diffraction data for the Mutant M298C6a of the small laccase (SLAC) from Streptomyces coelicolor
X-ray diffraction data for the GlfT2 from Nocardia brasiliensis Bound to Galf Trisaccharide
X-ray diffraction data for the GlfT2 from Nocardia brasiliensis Bound to Galf Tetrasaccharide
X-ray diffraction data for the Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 Form 1
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VSZ6
Resolution: 1.80 Å
R/Rfree: 0.21/0.25
X-ray diffraction data for the Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VSZ6
Resolution: 1.51 Å
R/Rfree: 0.18/0.21
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of bacterial extracellular solute-binding protein from Bordetella bronchiseptica RB50
CSBID
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) T376D, S395D Mutant from Trypanosoma brucei (AMP-PNP)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q582V7
Resolution: 2.15 Å
R/Rfree: 0.22/0.25
X-ray diffraction data for the Crystal structure of Capsular polysaccharide biosynthesis protein from Bordetella pertussis in complex with NAD and uridine-diphosphate-n-acetylgalactosamine (cocrystallization)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7TTK0
Resolution: 1.70 Å
R/Rfree: 0.15/0.18
X-ray diffraction data for the Co-crystal structure of 53BP1 tandem Tudor domains in complex with UNC8531
SGC
X-ray diffraction data for the Crystal structure of the WDR domain of human DCAF1 in complex with OICR-6766
SGC
X-ray diffraction data for the Co-crystal structure of human CARM1 in complex with MT556 inhibitor
SGC
X-ray diffraction data for the Drosophila melanogaster setdb1-tuor domain
SGC
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P21 form)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 2.15 Å
R/Rfree: 0.18/0.22
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P1 form)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 1.60 Å
R/Rfree: 0.16/0.18
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction
SnowShieldsCC1
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC, crystal soaked in alternate solvent prior to diffraction
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
SnowShieldsCC1
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional G/C rich expansion sequence
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
SnowShieldsCC1
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG
SnowShieldsCC1
X-ray diffraction data for the TUDOR DOMAIN OF TUMOR SUPPRESSOR P53BP1 WITH MFP-6008
SGC
X-ray diffraction data for the Crystal structure of human EED
SGC
X-ray diffraction data for the Crystal Structure of Apurinic endonuclease (APN1) from Babesia bovis
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: S6B9Y3
Resolution: 2.65 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal structure of human CORO6
SGC
X-ray diffraction data for the Crystal structure of BRPF2 PWWP domain in complex with DNA
SGC
X-ray diffraction data for the Crystal structure of SR-related and CTD-associated factor 4(SCAF4-CID)with peptide S2,S5p-CTD
SGC
X-ray diffraction data for the Crystal Structure of the Apo Form of Human RBBP7
SGC
X-ray diffraction data for the Discovery of small molecule antagonists of human Retinoblastoma Binding Protein 4 (RBBP4)
SGC
X-ray diffraction data for the Histone-lysine N-methyltransferase NSD2-PWWP1 with compound MRT10241866a
SGC
X-ray diffraction data for the Crystal structure of human BAZ2A
SGC
X-ray diffraction data for the Crystal structure of BAZ2A with DNA
SGC
X-ray diffraction data for the Crystal structure of MBD2 with DNA
SGC
X-ray diffraction data for the Crystal structure of MBD2 with DNA
SGC
X-ray diffraction data for the Crystal structure of MBD2 with DNA
SGC
X-ray diffraction data for the Crystal Structure of chromodomain of CDYL in complex with inhibitor UNC6261
SGC
X-ray diffraction data for the Co-crystal structure of human PRMT9 in complex with MT556 inhibitor
SGC
X-ray diffraction data for the Crystal structure of Glutathione Transferase from Shrimp Litopenaeus vannamei in complex with silver ions and a molecules of Glutathione binding in G-site and H-site
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) from Trypanosoma cruzi in complex with Hesperadin
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q4E2L0
Resolution: 2.72 Å
R/Rfree: 0.22/0.27
X-ray diffraction data for the Crystal structure of Guanylate Kinase from Burkholderia thailandensis in complex with GMP
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q2SY72
Resolution: 3.02 Å
R/Rfree: 0.20/0.25
X-ray diffraction data for the Crystal structure of Guanylate Kinase from Burkholderia thailandensis in complex with GDP
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q2SY72
Resolution: 2.96 Å
R/Rfree: 0.20/0.26
X-ray diffraction data for the Crystal structure of Formyl-coenzyme A transferase from Brucella melitensis in complex with CoA
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q8YDF2
Resolution: 1.85 Å
R/Rfree: 0.17/0.19
X-ray diffraction data for the Crystal structure of Formyl-coenzyme A transferase from Brucella melitensis in complex with Zinc
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q8YDF2
Resolution: 2.34 Å
R/Rfree: 0.22/0.26
X-ray diffraction data for the Crystal Structure of the Chaperonin GroEL apical domain from Bordetella pertussis
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: P48210
Resolution: 2.95 Å
R/Rfree: 0.21/0.25
X-ray diffraction data for the Crystal Structure of a Ribokinase from Brucella suis in complex ADP (P21 form)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A0A0H3GDY9
Resolution: 2.90 Å
R/Rfree: 0.24/0.29