6862 results
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
