Show:

6847 results

X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) T376D, S395D Mutant from Trypanosoma brucei (AMP-PNP)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q582V7
Resolution: 2.15 Å
R/Rfree: 0.22/0.25
X-ray diffraction data for the Crystal structure of Capsular polysaccharide biosynthesis protein from Bordetella pertussis in complex with NAD and uridine-diphosphate-n-acetylgalactosamine (cocrystallization)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7TTK0
Resolution: 1.70 Å
R/Rfree: 0.15/0.18
X-ray diffraction data for the Co-crystal structure of 53BP1 tandem Tudor domains in complex with UNC8531
SGC
X-ray diffraction data for the Crystal structure of the WDR domain of human DCAF1 in complex with OICR-6766
SGC
X-ray diffraction data for the Co-crystal structure of human CARM1 in complex with MT556 inhibitor
SGC
X-ray diffraction data for the Drosophila melanogaster setdb1-tuor domain
SGC
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P21 form)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 2.15 Å
R/Rfree: 0.18/0.22
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P1 form)
SSGCID
First author: Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 1.60 Å
R/Rfree: 0.16/0.18
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
SnowShieldsCC1