6886 results
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
X-ray diffraction data for the Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional G/C rich expansion sequence
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG
X-ray diffraction data for the TUDOR DOMAIN OF TUMOR SUPPRESSOR P53BP1 WITH MFP-6008
X-ray diffraction data for the Crystal structure of human EED
X-ray diffraction data for the Crystal Structure of Apurinic endonuclease (APN1) from Babesia bovis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: S6B9Y3
Resolution: 2.65 Å
R/Rfree: 0.21/0.26
Uniprot: S6B9Y3
Resolution: 2.65 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal structure of human CORO6
X-ray diffraction data for the Crystal structure of BRPF2 PWWP domain in complex with DNA
X-ray diffraction data for the Crystal structure of SR-related and CTD-associated factor 4(SCAF4-CID)with peptide S2,S5p-CTD
X-ray diffraction data for the Crystal Structure of the Apo Form of Human RBBP7
X-ray diffraction data for the Discovery of small molecule antagonists of human Retinoblastoma Binding Protein 4 (RBBP4)
X-ray diffraction data for the Histone-lysine N-methyltransferase NSD2-PWWP1 with compound MRT10241866a
X-ray diffraction data for the Crystal structure of human BAZ2A
X-ray diffraction data for the Crystal structure of BAZ2A with DNA
X-ray diffraction data for the Crystal structure of MBD2 with DNA
X-ray diffraction data for the Crystal structure of MBD2 with DNA
X-ray diffraction data for the Crystal structure of MBD2 with DNA
X-ray diffraction data for the Crystal Structure of chromodomain of CDYL in complex with inhibitor UNC6261
X-ray diffraction data for the Co-crystal structure of human PRMT9 in complex with MT556 inhibitor
X-ray diffraction data for the Crystal structure of Glutathione Transferase from Shrimp Litopenaeus vannamei in complex with silver ions and a molecules of Glutathione binding in G-site and H-site
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) from Trypanosoma cruzi in complex with Hesperadin
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q4E2L0
Resolution: 2.72 Å
R/Rfree: 0.22/0.27
Uniprot: Q4E2L0
Resolution: 2.72 Å
R/Rfree: 0.22/0.27
X-ray diffraction data for the Crystal structure of Guanylate Kinase from Burkholderia thailandensis in complex with GMP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q2SY72
Resolution: 3.02 Å
R/Rfree: 0.20/0.25
Uniprot: Q2SY72
Resolution: 3.02 Å
R/Rfree: 0.20/0.25
X-ray diffraction data for the Crystal structure of Guanylate Kinase from Burkholderia thailandensis in complex with GDP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q2SY72
Resolution: 2.96 Å
R/Rfree: 0.20/0.26
Uniprot: Q2SY72
Resolution: 2.96 Å
R/Rfree: 0.20/0.26
X-ray diffraction data for the Crystal structure of Formyl-coenzyme A transferase from Brucella melitensis in complex with CoA
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q8YDF2
Resolution: 1.85 Å
R/Rfree: 0.17/0.19
Uniprot: Q8YDF2
Resolution: 1.85 Å
R/Rfree: 0.17/0.19
X-ray diffraction data for the Crystal structure of Formyl-coenzyme A transferase from Brucella melitensis in complex with Zinc
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q8YDF2
Resolution: 2.34 Å
R/Rfree: 0.22/0.26
Uniprot: Q8YDF2
Resolution: 2.34 Å
R/Rfree: 0.22/0.26
X-ray diffraction data for the Crystal Structure of the Chaperonin GroEL apical domain from Bordetella pertussis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: P48210
Resolution: 2.95 Å
R/Rfree: 0.21/0.25
Uniprot: P48210
Resolution: 2.95 Å
R/Rfree: 0.21/0.25
X-ray diffraction data for the Crystal Structure of a Ribokinase from Brucella suis in complex ADP (P21 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A0A0H3GDY9
Resolution: 2.90 Å
R/Rfree: 0.24/0.29
Uniprot: A0A0H3GDY9
Resolution: 2.90 Å
R/Rfree: 0.24/0.29
X-ray diffraction data for the Crystal Structure of the SET Domain of Human Histone-Lysine N-Methyltransferase SUV420H1 in complex with RQ3-111
X-ray diffraction data for the Crystal structure of the WD-repeat domain of human WDR91 in complex with MR45279
X-ray diffraction data for the Co-crystal structure of the WD-repeat domain of human WDR91 in complex with MR46654
X-ray diffraction data for the Crystal structure of Fab 3.10C2 bound to TREM2
X-ray diffraction data for the Crystal structure of human DDX1 helicase in complex with ADP
X-ray diffraction data for the Histone-lysine N-methyltransferase NSD2-PWWP1 with compound UNC6934
X-ray diffraction data for the Crystal structure of HP1gamma chromoshadow domain in complex with KAP1 peptide
X-ray diffraction data for the Crystal structure of the human COPB2 WD-domains
X-ray diffraction data for the Crystal structure of the human COPB2 WD-domain in complex with OICR-6254
X-ray diffraction data for the Drosophila melanogaster setdb1-tuor domain with peptide H3K9me2K14ac
X-ray diffraction data for the Crystal structure of monomeric Atg23
X-ray diffraction data for the Crystal structure of an Iole protein from Brucella melitensis (orthorhombic P form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q8YCG0
Resolution: 2.10 Å
R/Rfree: 0.19/0.23
Uniprot: Q8YCG0
Resolution: 2.10 Å
R/Rfree: 0.19/0.23
X-ray diffraction data for the Crystal structure of a Iole protein from Brucella melitensis (orthorhombic P form 2)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q8YCG0
Resolution: 2.30 Å
R/Rfree: 0.19/0.24
Uniprot: Q8YCG0
Resolution: 2.30 Å
R/Rfree: 0.19/0.24
X-ray diffraction data for the Crystal structure of an Iole protein from Brucella melitensis (cobalt complex)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q8YCG0
Resolution: 2.30 Å
R/Rfree: 0.19/0.24
Uniprot: Q8YCG0
Resolution: 2.30 Å
R/Rfree: 0.19/0.24
X-ray diffraction data for the Crystal Structure of 6,7-dimethyl-8-ribityllumazine synthase from Bordetella pertussis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VTN4
Resolution: 2.34 Å
R/Rfree: 0.21/0.26
Uniprot: Q7VTN4
Resolution: 2.34 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal Structure of 6,7-dimethyl-8-ribityllumazine synthase from Bordetella pertussis in complex with 6,7-dimethyl-8-(1'-D-ribityl) lumazine
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VTN4
Resolution: 2.15 Å
R/Rfree: 0.22/0.26
Uniprot: Q7VTN4
Resolution: 2.15 Å
R/Rfree: 0.22/0.26
X-ray diffraction data for the Crystal structure of nucleoside-diphosphate kinase Cryptosporidium parvum (Apo, hexamer)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q5CR64
Resolution: 1.48 Å
R/Rfree: 0.13/0.16
Uniprot: Q5CR64
Resolution: 1.48 Å
R/Rfree: 0.13/0.16
X-ray diffraction data for the Crystal structure of Phosphoribosylaminoimidazole carboxylase from Burkholderia xenovorans (ATP complex)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q13UJ9
Resolution: 1.93 Å
R/Rfree: 0.17/0.20
Uniprot: Q13UJ9
Resolution: 1.93 Å
R/Rfree: 0.17/0.20
X-ray diffraction data for the Crystal structure of Phosphoribosylaminoimidazole carboxylase from Burkholderia xenovorans (AMP complex)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q13UJ9
Resolution: 2.19 Å
R/Rfree: 0.17/0.20
Uniprot: Q13UJ9
Resolution: 2.19 Å
R/Rfree: 0.17/0.20
X-ray diffraction data for the Crystal structure of Glutamate--tRNA ligase (GltX) from Moraxella catarrhalis (Apo)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A0AB36DQE3
Resolution: 2.75 Å
R/Rfree: 0.22/0.26
Uniprot: A0AB36DQE3
Resolution: 2.75 Å
R/Rfree: 0.22/0.26
X-ray diffraction data for the Equine Serum Albumin with Copper(II)
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor WIN-3-115
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.94 Å
R/Rfree: 0.20/0.25
Uniprot: A3FQ16
Resolution: 2.94 Å
R/Rfree: 0.20/0.25
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor BKI-1606
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.75 Å
R/Rfree: 0.21/0.26
Uniprot: A3FQ16
Resolution: 2.75 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal structure of a calcium bound C2 domain containing protein from Trichomonas vaginalis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.40 Å
R/Rfree: 0.14/0.17
Uniprot: A2EZR3
Resolution: 1.40 Å
R/Rfree: 0.14/0.17
X-ray diffraction data for the Crystal structure of a calcium bound C2 domain containing protein from Trichomonas vaginalis (P21 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.51 Å
R/Rfree: 0.19/0.21
Uniprot: A2EZR3
Resolution: 1.51 Å
R/Rfree: 0.19/0.21
X-ray diffraction data for the Crystal structure of a calcium bound C2 domain containing protein from Trichomonas vaginalis (orthorhombic P form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.53 Å
R/Rfree: 0.23/0.26
Uniprot: A2EZR3
Resolution: 1.53 Å
R/Rfree: 0.23/0.26
X-ray diffraction data for the Crystal structure of a C2 domain containing protein from Trichomonas vaginalis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.35 Å
R/Rfree: 0.15/0.17
Uniprot: A2EZR3
Resolution: 1.35 Å
R/Rfree: 0.15/0.17
X-ray diffraction data for the Crystal structure of a malonate bound C2 domain containing protein from Trichomonas vaginalis (P21 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.30 Å
R/Rfree: 0.14/0.17
Uniprot: A2EZR3
Resolution: 1.30 Å
R/Rfree: 0.14/0.17
X-ray diffraction data for the Crystal structure of a calcium bound C2 domain containing protein from Trichomonas vaginalis (P61 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.54 Å
R/Rfree: 0.17/0.20
Uniprot: A2EZR3
Resolution: 1.54 Å
R/Rfree: 0.17/0.20
X-ray diffraction data for the Crystal structure of a C2 domain containing protein from Trichomonas vaginalis in complex with pyrophosphate
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A2EZR3
Resolution: 1.70 Å
R/Rfree: 0.21/0.23
Uniprot: A2EZR3
Resolution: 1.70 Å
R/Rfree: 0.21/0.23
X-ray diffraction data for the Crystal structure of a Heat shock protein (DnaJ) from Brucella melitensis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YMC9
Resolution: 3.09 Å
R/Rfree: 0.24/0.29
Uniprot: Q2YMC9
Resolution: 3.09 Å
R/Rfree: 0.24/0.29
X-ray diffraction data for the Crystal structure of Phosphoglycerate mutase from Trichomonas vaginalis in complex with 3-phosphoglyceric acid
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A2DUN8
Resolution: 2.10 Å
R/Rfree: 0.18/0.21
Uniprot: A2DUN8
Resolution: 2.10 Å
R/Rfree: 0.18/0.21
X-ray diffraction data for the Crystal structure of Glutamate-tRNA synthetase GluRS from Chlamydia pneumoniae (Orthorhombic C form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q9Z7Z3
Resolution: 2.75 Å
R/Rfree: 0.22/0.26
Uniprot: Q9Z7Z3
Resolution: 2.75 Å
R/Rfree: 0.22/0.26
X-ray diffraction data for the Crystal structure of Glutamate-tRNA synthetase GluRS from Chlamydia pneumoniae in complex with ATP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q9Z7Z3
Resolution: 2.65 Å
R/Rfree: 0.21/0.26
Uniprot: Q9Z7Z3
Resolution: 2.65 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal Structure of CBS domain containing protein from Burkholderia phymatum
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: B2JRV0
Resolution: 1.39 Å
R/Rfree: 0.16/0.19
Uniprot: B2JRV0
Resolution: 1.39 Å
R/Rfree: 0.16/0.19
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) from Trypanosoma brucei
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q582V7
Resolution: 2.05 Å
R/Rfree: 0.19/0.23
Uniprot: Q582V7
Resolution: 2.05 Å
R/Rfree: 0.19/0.23
X-ray diffraction data for the Crystal structure of a glyceraldehyde-3-phosphate dehydrogenase from Neisseria gonorrhoeae in complex with NAD (P1 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: B4RPP8
Resolution: 2.30 Å
R/Rfree: 0.19/0.23
Uniprot: B4RPP8
Resolution: 2.30 Å
R/Rfree: 0.19/0.23
X-ray diffraction data for the Crystal structure of a glyceraldehyde-3-phosphate dehydrogenase from Neisseria gonorrhoeae in complex with NAD and GLYCERALDEHYDE-3-PHOSPHATE
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: B4RPP8
Resolution: 1.91 Å
R/Rfree: 0.15/0.19
Uniprot: B4RPP8
Resolution: 1.91 Å
R/Rfree: 0.15/0.19
X-ray diffraction data for the Crystal structure of Formyl-coenzyme A transferase from Brucella melitensis in complex with succinate
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q8YDF2
Resolution: 2.88 Å
R/Rfree: 0.19/0.23
Uniprot: Q8YDF2
Resolution: 2.88 Å
R/Rfree: 0.19/0.23
X-ray diffraction data for the Crystal structure of Human Prostaglandin reductase 1 (PTGR1) in complex with NADP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q14914
Resolution: 2.00 Å
R/Rfree: 0.17/0.21
Uniprot: Q14914
Resolution: 2.00 Å
R/Rfree: 0.17/0.21
X-ray diffraction data for the Crystal structure of Human Prostaglandin reductase 1 (PTGR1) in complex with NADP and Indomethacin
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: Q14914
Resolution: 2.10 Å
R/Rfree: 0.20/0.24
Uniprot: Q14914
Resolution: 2.10 Å
R/Rfree: 0.20/0.24