29 results
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional G/C rich expansion sequence
X-ray diffraction data for the Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization
