29 results
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
