Diffraction project datasets CC1_21_TGGGAAGATACTGGATGAGGT_empty_9yzk
- Resolution: 5.1 Å
- Space group: I 1 2 1
Uniprot website for P03856
PDB website for 9YZK
PDB validation report for 9YZK
doi:10.18430/M39YZK
Project details
| Title | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
| Authors | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. |
| R / Rfree | 0.28 / 0.30 |
| Unit cell edges [Å] | 75.84 x 163.02 x 192.28 |
| Unit cell angles [°] | 90.0, 98.6, 90.0 |
Dataset run_29_#####.cbf details
| Number of frames | 249 (472 - 720) |
| Distance [mm] | 350.0 |
| Oscillation width [°] | 0.25 |
| Omega [°] | 118.0 |
| Wavelength [Å] | 1.00002 |
| Experiment Date | 2023-10-13 |
| Equipment | 8.2.2 at ALS (Advanced Light Source) |